Journal: mSphere

Article Title: Posttranslational Regulation of Botulinum Neurotoxin Production in Clostridium botulinum Hall A- hyper

doi: 10.1128/mSphere.00328-21

Figure Lengend Snippet: Plasmids and primers used in this study

Article Snippet: pMTL0007C-E2: ArcB-156a , ClosTron plasmid targeted to the Hall A- hyper arcB gene (CLC2465) , DNA2.0 (Atum).

Techniques: Sequencing, Plasmid Preparation

Journal: mSphere

Article Title: Posttranslational Regulation of Botulinum Neurotoxin Production in Clostridium botulinum Hall A- hyper

doi: 10.1128/mSphere.00328-21

Figure Lengend Snippet: Plasmids and primers used in this study

Article Snippet: pMTL0007C-E2: ArgG-147a , ClosTron plasmid targeted to the Hall A- hyper argG gene (CLC2544) , DNA2.0 (Atum).

Techniques: Sequencing, Plasmid Preparation

Journal: Scientific Reports

Article Title: MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material recruitment

doi: 10.1038/srep27284

Figure Lengend Snippet: ( A ) Immunofluorescence images showing the distribution of endogenous MCRS1 and the centriolar satellite marker PCM1 (upper panels). RPE1 cells transiently expressing EGFP-tagged MCRS1 were stained with PCM1 antibody (lower panels). ( B ) RPE1 cells transiently expressing EGFP-tagged MCRS1 were treated with nocodazole for 1 hr, and then stained with α-Tubulin antibody with or without nocodazole washout (5 min wash). The graph shows quantification of cells exhibiting pericentrosomal accumulation of MCRS1-GFP-positive granules: (-) without nocodazole treatment, (+) after 1 hr nocodazole treatment, and (wash) after 1 hr nocodazole treatment followed by 5 min washout. ( C ) HEK293T cells were transfected with the indicated plasmids for 16 hr, and then cell lysates were immunoprecipitated with anti-FLAG antibody conjugated with agarose beads. The resulting precipitates and input lysates were immunoblotted with the indicated antibodies. Arrow indicates bands at the molecular weight of DYNC1l1-GFP. ( D ) Immunofluorescence images showing the distribution of PCM1-containing granules and the Golgi complex after transfection of the indicated siRNAs for 3 days. Scale bars represent 10 μm.

Article Snippet: TALEN plasmids targeting the exon 4 of zebrafish mcrs1 gene were designed and constructed by ToolGen: left TALEN, TTGAGCCAATCAGATGCCCT; right TALEN, ATGTCCAGCGACAAGAAAAA.

Techniques: Immunofluorescence, Marker, Expressing, Staining, Transfection, Immunoprecipitation, Molecular Weight

Journal: Scientific Reports

Article Title: MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material recruitment

doi: 10.1038/srep27284

Figure Lengend Snippet: ( A ) Schematic representation of domain structures of MCRS1, and subcellular localization of truncated forms of MCRS1. RPE1 cells transiently expressing the indicated constructs were stained with anti-PCM1 antibody. Insets are magnified view of the centrosomal area. ( B ) RPE1 cells expressing the indicated constructs were stained with anti-Giantin antibody. Quantification of the influence of the indicated constructs on Golgi organization visualized as in B. Transfected cells were classified into four groups based on the distribution of the Golgi apparatus. Scale bars represent 10 μm.

Article Snippet: TALEN plasmids targeting the exon 4 of zebrafish mcrs1 gene were designed and constructed by ToolGen: left TALEN, TTGAGCCAATCAGATGCCCT; right TALEN, ATGTCCAGCGACAAGAAAAA.

Techniques: Expressing, Construct, Staining, Transfection

Journal: Scientific Reports

Article Title: MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material recruitment

doi: 10.1038/srep27284

Figure Lengend Snippet: ( A ) RPE1 cells were transfected with siRNAs for 24 hr, and then serum-starved for 2 days. Cilia were stained with anti-polyglutamylated Tubulin antibody. The graph shows quantification of ciliated cells. Error bars represent SEM (n=3 independent experiments; *P < 0.05 and **P < 0.01, t test). ( B ) Immunofluorescence analysis of CP110 cap removal from the mother centriole. Cells were transfected with siRNAs for 48 hr, and then serum-starved for 24 hr. The graph shows quantification of cells with single CP110 dot in the centrosome. Error bars represent SEM (n=3 independent experiments). ( C ) Immunofluorescence analysis of TTBK2 recruitment to the mother centriole. Cells were transfected with siRNAs for 56 hr, and then serum-starved for 16 hr. The scatter plot shows quantification of immunofluorescence intensities of TTBK2 at the centrosomal area. Error bars represent SEM (more than 100 cells were examined for each group; *P < 0.05, t test). ( D ) Immunofluorescence images of a RPE1 cell expressing MCRS1-FLAG and TTBK2-GFP. (E) HEK293T cells were transfected with the indicated plasmids for 16 hr. Cell lysates were immunoprecipitated with anti-FLAG antibody conjugated with agarose beads. The resulting precipitates and input lysates were immunoblotted with the indicated antibodies. Arrow and arrowhead indicate bands at the molecular weight of MCRS1-FLAG and TTBK2-GFP, respectively. Scale bars represent 10 μm ( A and D ) and 2 μm ( B and C ).

Article Snippet: TALEN plasmids targeting the exon 4 of zebrafish mcrs1 gene were designed and constructed by ToolGen: left TALEN, TTGAGCCAATCAGATGCCCT; right TALEN, ATGTCCAGCGACAAGAAAAA.

Techniques: Transfection, Staining, Immunofluorescence, Expressing, Immunoprecipitation, Molecular Weight

Journal: Scientific Reports

Article Title: MCRS1 associates with cytoplasmic dynein and mediates pericentrosomal material recruitment

doi: 10.1038/srep27284

Figure Lengend Snippet: ( A ) Homozygous mcrs1 mutant zebrafish exhibited a curved body axis at 72 hpf. ( B ) Measurement of the size of the eye and the brain (n>10 for each genotype; **P < 0.01, t test). ( C ) Disruption of retinal lamination in mcrs1 mutant zebrafish at 72 hpf. ( D ) Melatonin-induced aggregation of melanosome was delayed in mcrs1 mutant zebrafish. (E) Cilia in the olfactory placode were visualized by staining with anti-acetylated tubulin antibody.

Article Snippet: TALEN plasmids targeting the exon 4 of zebrafish mcrs1 gene were designed and constructed by ToolGen: left TALEN, TTGAGCCAATCAGATGCCCT; right TALEN, ATGTCCAGCGACAAGAAAAA.

Techniques: Mutagenesis, Disruption, Staining